site stats

Myh6 mercremer

Web18 dec. 2024 · Myh6-driven Cre recombinase activates the DNA damage response and the cell cycle in the myocardium in the absence of loxP sites. Regeneration of muscle in the … WebIn this study, we generated a Myh6-Cre knockin mouse model by inserting the IRES-Cre-wpre-polyA cassette between the translational stop codon and the 3' untranslated region of the endogenous Myh6 gene. By crossing knockin mice with the Rosa26 reporter lines, we found that Myh6-Cre targeted cardiomyocytes at the embryonic and postnatal stages.

Measuring cardiomyocyte cell-cycle activity and proliferation in …

WebThen, Hmgb1 flox/+; Myh6-MerCreMer mice were crossed with Hmgb1 flox/flox mice to produce hmgb1 flox/flox; Myh6-MerCreMer homozygous mice. For tamoxifen-induced … Web23 jul. 2015 · Mhy6 encodes a cardiac muscle specific protein: alpha-myosin heavy chain. Here, we generated a new Myh6-MerCreMer (Myh6MerCreMer/+) inducible Cre knock … dragon\u0027s tooth trefethen https://davidsimko.com

A Murine Myh6 MerCreMer Knock-In Allele Specifically Mediates

Web11 jun. 2009 · Materials and Methods. Myh6-MerCreMer +/+ transgenic mice (no. 005650, Jackson Labs, Bar Harbor, Me) were used. Myh6-MCM +/− /no-flox were generated by … WebMyh6 Cre Esr1 1jmk J Mercremer Mice, supplied by The Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS … Web8 jun. 2024 · We generated Myh6-MerCreMer;Confetti +/− (MCM;Confetti) mice in which a single dose of tamoxifen leads to stochastic, indelible labeling of cardiomyocytes with 1 of 4 fluorescent proteins (Figure [A]). 4 By pulsing tamoxifen at postnatal day (P) 0 to P1, before significant binucleation or polyploidization occurs, 1,2 we ensured that labeled … dragon\u0027s upside down house

role of G protein-coupled receptor kinase 4 in cardiomyocyte …

Category:(PDF) A Murine Myh6MerCreMer Knock-In Allele ... - ResearchGate

Tags:Myh6 mercremer

Myh6 mercremer

Full article: Perinatal versus adult loss of ULK1 and ULK2 distinctly ...

WebThe MerCreMer-FRT-Neo-FRT cassette was inserted into the Myh6 locus (6 bp upstream ATG). The Neo cassette was removed by crossing Myh6MerCreMer-Neo/+ mice with … Web20 sep. 2024 · Myh6, also known as αMHC, Myhc and Myhca, encodes the cardiac muscle specific protein, alpha-myosin heavy chain, which is dynamically expressed in …

Myh6 mercremer

Did you know?

Web12 apr. 2024 · Furthermore, we generated Myh6-merCremer;ThraDN/+ miceandinducedDN-TRa expression around the perinatal window (fig. S10). Increased … Web23 jul. 2015 · Here, we generated a new Myh6-MerCreMer (Myh6(MerCreMer/+)) inducible Cre knock-in mouse by inserting a MerCreMer cassette into the Myh6 start codon. By …

WebMutations in theLMNAgene encoding nuclear lamins A/C cause a diverse array of tissue-selective diseases, with the heart being the most commonly affected organ. Despite … WebMyh6 Mcm, supplied by The Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, …

Web31 jul. 2014 · Notably, Myh6 (α-MHC)-MerCreMer transgenic mice, 1 where Cre activity is induced by the application of tamoxifen or raloxifene, have become a valuable tool for … Web15 dec. 2012 · Neither the heterozygous Myh6-MerCreMer/LepR flox/WT nor the Myh6-MerCreMer mice exhibited any overt signs of heart failure as observed in the …

Web5 jan. 2024 · Myh6-Mcm: Myosin heavy chain 6-MerCreMer; F/M: female/male; HR: heart rate; bpm: beats per minute; AWT: anterior wall thickness; LVPWT: left ventricular …

Web23 okt. 2024 · Myh6-MerCreMer+/+ AKAP2fl/fl mice. The presence of the MerCreMer transgene was confirmed by PCR, using the Cre-F sense primer (ATACCGGAGATCATGCA AGC) and the Cre-R anti-sense primer (AGGTGGACCTGATCATGGAG). 2.2. Animal Procedures All animal experiments were … dragon\u0027s towerWeb9 sep. 2024 · Myh6 encodes one of two myosin heavy chain proteins for cardiac contraction 32, and the Myh6 promoter has been used to express Cre or CreER in cardiomyocytes. Tg (Myh6-cre)2182Mds drives... emma raducanu face of diorWebTg (Myh6-cre/Esr1*)1Liao Transgene Detail Summary Transgene origin Transgene description Recombinase activity Phenotypes Disease models Find Mice (IMSR) … dragon\u0027s watchWeb6 jul. 2001 · In summary, MerCreMer transgenic mice represent a tool for temporally regulated inactivation of any loxP-targeted gene within the developing and adult heart or for specifically directing recombination and expression of a loxP-inactivated cardiac transgene in the heart. Publication types Research Support, Non-U.S. Gov't dragon\u0027s watch voucher packWebMyh6-MerCreMer+/+ AKAP2fl/fl mice. The presence of the MerCreMer transgene was confirmed by PCR, using the Cre-F sense primer (ATACCGGAGATCATGCA AGC) and … dragon\u0027s twilightdragon\u0027s weaving tool component materialsWebTg (Myh6-cre/Esr1*)1Liao Transgene Detail Summary Transgene origin Transgene description Recombinase activity Phenotypes Disease models Find Mice (IMSR) References Summary Transgene origin Strain of Origin: Not Applicable Transgene description Recombinase activity Phenotypes emma raducanu fashion shoot